Display Settings:

Format

Send to:

Choose Destination
Pr012698496

Eukaryota (5 taxa) STS probe REN116494 for H19, imprinted maternally expressed transcript (non-protein coding) (H19) and 4 more genes

Synopsis

Field NameValues
NameREN116494
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100395615 (Callithrix jacchus); LOC100452997 (Pongo abelii); LOC100584817 (Nomascus leucogenys); H19 (Macaca mulatta); H19 (Pan troglodytes)
UniSTS IDUniSTS:441289

Sequences

>Probe|12698496|PRIMERF Forward PCR primer (outermost) (21b)
GAGATGGGGCGTAATGGAATG
>Probe|12698496|PRIMERR Reverse PCR primer (outermost) (22b)
ATTTGCACTGGTTGGAGTTGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmREN116494

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID441289
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk