Display Settings:

Format

Send to:

Choose Destination
Pr012694808

STS probe D4S3315 for chemokine (C-X-C motif) ligand 9 (CXCL9) and 4 more genes

Synopsis

Field NameValues
NameD4S3315
AliasesSHGC-17162
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCXCL9; ART3; CXCL9; CXCL9; CXCL9
UniSTS IDUniSTS:43797

Sequences

>Probe|12694808|PRIMERF Forward PCR primer (outermost) (20b)
GAGAAAGCCCTTTTCCTTCG
>Probe|12694808|PRIMERR Reverse PCR primer (outermost) (20b)
ACAGGGATGTTTGCTCAGCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmD4S3315

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID43797
Probe Cross-refcontext specific help for: Probe Cross-refGDB:734356
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk