Display Settings:

Format

Send to:

Choose Destination
Pr012691967

STS probe A004Q15 for synaptic vesicle glycoprotein 2B (SV2B) and 1 more gene

Synopsis

Field NameValues
NameA004Q15
AliasesRH25789
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100128403; SV2B
UniSTS IDUniSTS:43541

Sequences

>Probe|12691967|PRIMERF Forward PCR primer (outermost) (23b)
GACTAATATGAGCAACTCTACAT
>Probe|12691967|PRIMERR Reverse PCR primer (outermost) (18b)
GTGAGTCATGAAAAGGAG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415329.23 cr3000A004Q15
Homo sapienslinkageRutgers Map15 cmA004Q15
Homo sapiensradiation hybridNCBI RH15711.8 crA004Q15

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID43541
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk