Display Settings:

Format

Send to:

Choose Destination
Pr012678959

Homo sapiens STS probe L77852

Synopsis

Field NameValues
NameL77852
AliasesHUMSWX2844; sWXD2844
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:42370

Sequences

>Probe|12678959|PRIMERF Forward PCR primer (outermost) (21b)
GAAGGTTTAGGTGGGATAATG
>Probe|12678959|PRIMERR Reverse PCR primer (outermost) (22b)
CATCTCTTGTCTGGACTATTTC

References

1.

X chromosome map at 75-kb STS resolution, revealing extremes of recombination and GC content.

Nagaraja R, MacMillan S, Kere J, Jones C, Griffin S, Schmatz M, Terrell J, Shomaker M, Jermak C, Hott C, Masisi M, Mumm S, Srivastava A, Pilia G, Featherstone T, Mazzarella R, Kesterson S, McCauley B, Railey B, Burough F, Nowotny V, D'Urso M, States D, Brownstein B, Schlessinger D.

Genome Res. 1997 Mar;7(3):210-22.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmL77852
Homo sapiensphysicalWUSTL-XX4.45 ordinalsWXD2844

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID42370
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk