Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012677193

Callithrix jacchus and Pan troglodytes STS probe D3S2338 for phospholipase C-like 2 (PLCL2) and 1 more gene

Synopsis

Field NameValues
NameD3S2338
AliasesA037ZF5; AFMA037ZF5; AFMa037zf5; HSA037ZF5; RH30799; SHGC-20091; W2819
TypeSTS
Application
Source organism
Source sequence
Target organismsCallithrix jacchus; Pan troglodytes; Homo sapiens
Target genesLOC100411015 (Callithrix jacchus); PLCL2 (Pan troglodytes)

Sequences

>Probe|12677193|PRIMERF Forward PCR primer (outermost) (17b)
GAAGCCAGCAGTTTCTC
>Probe|12677193|PRIMERR Reverse PCR primer (outermost) (22b)
CTGTATTGTTTTCCAGGATAAG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S2338
Homo sapienslinkageMarshfield342.1 cmAFMa037zf5
Homo sapienslinkagedeCODE337.49 cmD3S2338
Homo sapienslinkageGenethon336.3 cmAFMa037zf5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID42211
Probe Cross-refcontext specific help for: Probe Cross-refGDB:343612
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk