Display Settings:

Format

Send to:

Choose Destination
Pr012675559

STS probe D20S852 for MACRO domain containing 2 (MACROD2) and 4 more genes

Synopsis

Field NameValues
NameD20S852
AliasesA224XF1; AFMa224xf1; HSA224XF1; RH31471; RH37531; SHGC-21123; W3078; stSG10768
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMACROD2; MACROD2; MACROD2; MACROD2; MACROD2
UniSTS IDUniSTS:42064

Sequences

>Probe|12675559|PRIMERF Forward PCR primer (outermost) (21b)
GAAGAACTGCACTGGGATACT
>Probe|12675559|PRIMERR Reverse PCR primer (outermost) (24b)
CCAGGAAATGTAAAAATACTTGAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 6 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

5.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

6.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G320773 cr10000SHGC-21123
Homo sapiensradiation hybridGeneMap99-G320806 cr10000AFMa224xf1
Homo sapienslinkageRutgers Map20 cmD20S852
Homo sapienslinkageMarshfield2036.58 cmAFMa224xf1
Homo sapienslinkagedeCODE2039.56 cmD20S852
Homo sapienslinkageGenethon2036.8 cmAFMa224xf1
Homo sapiensradiation hybridNCBI RH20118.7 crAFMa224xf1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID42064
Probe Cross-refcontext specific help for: Probe Cross-refGDB:607293
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk