Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012670073

Eukaryota (5 taxa) STS probe D15S131 for leucine rich repeat containing 49 (LRRC49) and 10 more genes

Synopsis

Field NameValues
NameD15S131
Aliases262XB1; AFM262XB1; AFM262xb1; HS262XB1
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLRRC49 (Pongo abelii); THAP10 (Pongo abelii); LRRC49 (Callithrix jacchus); THAP10 (Callithrix jacchus); LOC100433956 (Pongo abelii); LRRC49 (Nomascus leucogenys); THAP10 (Nomascus leucogenys); LRRC49 (Pan troglodytes); THAP10 (Pan troglodytes); LRRC49 (Homo sapiens); THAP10 (Homo sapiens)

Sequences

>Probe|12670073|PRIMERF Forward PCR primer (outermost) (18b)
GAAAGGCACCTCATCTCG
>Probe|12670073|PRIMERR Reverse PCR primer (outermost) (20b)
TTAAAAACTCTGGAGCAGCG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmD15S131
Homo sapienslinkageMarshfield1571.28 cmAFM262xb1
Homo sapienslinkageGenethon1570.7 cmAFM262xb1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID41570
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188733
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk