Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012668030

Eukaryota (6 taxa) STS probe REN89063 for opsin 1 (cone pigments), medium-wave-sensitive (OPN1MW) and 7 more genes

Synopsis

Field NameValues
NameREN89063
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100412476 (Callithrix jacchus); OPN1MW (Pongo abelii); OPN1MW (Nomascus leucogenys); OPN1MW (Homo sapiens); OPN1LW (Homo sapiens); OPN1LW (Macaca mulatta); OPN1MW2 (Homo sapiens); OPN1LW (Pan troglodytes)

Sequences

>Probe|12668030|PRIMERF Forward PCR primer (outermost) (24b)
ATAATGGAAGGAAATGCCCAGTGT
>Probe|12668030|PRIMERR Reverse PCR primer (outermost) (21b)
CCACCTCTCCCAGGAAATGAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID413861
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Write to the Help Desk