Display Settings:

Format

Send to:

Choose Destination
Pr012666985

STS probe D10S2398 for family with sequence similarity 149, member B1 (FAM149B1) and 5 more genes

Synopsis

Field NameValues
NameD10S2398
AliasesRH8867; SHGC-15340
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFAM149B1; FAM149B1; FAM149B1; FAM149B1; FAM149B1; FAM149B1
UniSTS IDUniSTS:41292

Sequences

>Probe|12666985|PRIMERF Forward PCR primer (outermost) (20b)
GAAAAGGCCAGCTTCTGTTG
>Probe|12666985|PRIMERR Reverse PCR primer (outermost) (24b)
TTAATGTGCACAGAAAGCTTTAGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3103363 cr10000SHGC-15340
Homo sapiensradiation hybridGeneMap99-G3103339 cr10000SHGC-15340
Homo sapienslinkageRutgers Map10 cmD10S2398
Homo sapiensradiation hybridNCBI RH10920.5 crSHGC-15340

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID41292
Probe Cross-refcontext specific help for: Probe Cross-refGDB:739991
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk