Display Settings:

Format

Send to:

Choose Destination
Pr012662987

STS probe SHGC-30447 for phospholipase C, beta 4 (PLCB4) and 5 more genes

Synopsis

Field NameValues
NameSHGC-30447
AliasRH14966
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPLCB4; PLCB4; PLCB4; PLCB4; PLCB4; PLCB4
UniSTS IDUniSTS:40932

Sequences

>Probe|12662987|PRIMERF Forward PCR primer (outermost) (21b)
CTTTGCCATATGTCTGCTTCC
>Probe|12662987|PRIMERR Reverse PCR primer (outermost) (20b)
GTGACCCCAAATTCCATGAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G320408 cr10000SHGC-30447
Homo sapiensradiation hybridGeneMap99-G320408 cr10000SHGC-30447
Homo sapienslinkageRutgers Map20 cmSHGC-30447
Homo sapiensradiation hybridNCBI RH2089.8 crSHGC-30447

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40932
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk