Display Settings:

Format

Send to:

Choose Destination
Pr012656056

STS probe D14S984 for dynein axonemal assembly factor 2 (DNAAF2) and 5 more genes

Synopsis

Field NameValues
NameD14S984
AliasesA175VF5; AFMA175VF5; AFMa175vf5; HSA175VF5; RH31309; SHGC-20858; W3042
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288937; LOC100291540; LOC100292339; DNAAF2; DNAAF2; RPL36AL
UniSTS IDUniSTS:40308

Sequences

>Probe|12656056|PRIMERF Forward PCR primer (outermost) (22b)
CTTGAATATGTGTTTCCCAGGT
>Probe|12656056|PRIMERR Reverse PCR primer (outermost) (20b)
CTGAGATCACGCAGTTGTAC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 5 References...

3.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

5.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3141443 cr10000SHGC-20858
Homo sapiensradiation hybridGeneMap99-G3141491 cr10000AFMa175vf5
Homo sapienslinkageRutgers Map14 cmD14S984
Homo sapienslinkageMarshfield1452.49 cmAFMa175vf5
Homo sapienslinkageGenethon1443.6 cmAFMa175vf5
Homo sapiensradiation hybridNCBI RH14464.7 crAFMa175vf5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID40308
Probe Cross-refcontext specific help for: Probe Cross-refGDB:605878
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk