Display Settings:

Format

Send to:

Choose Destination
Pr012652511

Eukaryota (4 taxa) STS probe D15S950 for FERM domain containing 5 (Frmd5) and 3 more genes

Synopsis

Field NameValues
NameD15S950
AliasesRH36876; RH36890; STS-Z38349; sts-Z38349
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Ornithorhynchus anatinus; Pan troglodytes; Homo sapiens; Canis lupus familiaris
Target genesFRMD5 (Ornithorhynchus anatinus); Frmd5 (Mus musculus); FRMD5 (Pan troglodytes); ENOX1 (Canis lupus familiaris)
UniSTS IDUniSTS:39989

Sequences

>Probe|12652511|PRIMERF Forward PCR primer (outermost) (20b)
CTTCATGGCACCAATGATTT
>Probe|12652511|PRIMERR Reverse PCR primer (outermost) (20b)
GTAAACTACCTGCAAATGTG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415152.48 cr3000sts-Z38349
Homo sapienslinkageRutgers Map15 cmD15S950
Homo sapiensradiation hybridNCBI RH15238.1 crsts-Z38349

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID39989
Probe Cross-refcontext specific help for: Probe Cross-refGDB:596578; RGD:5034353
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk