Display Settings:

Format

Send to:

Choose Destination
Pr012648256

STS probe REN71255 for interleukin 4 (IL4) and 1 more gene

Synopsis

Field NameValues
NameREN71255
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIL4; IL4
UniSTS IDUniSTS:396055

Sequences

>Probe|12648256|PRIMERF Forward PCR primer (outermost) (23b)
GGGAAAGCATAGAAGCAAGATGG
>Probe|12648256|PRIMERR Reverse PCR primer (outermost) (24b)
ATCCCAAATCTGTTCACCTCAACT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map5 cmREN71255

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID396055
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk