Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012645605

Homo sapiens STS probe D12S817

Synopsis

Field NameValues
NameD12S817
AliasesHUMUT1666; UT1666
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens

Sequences

>Probe|12645605|PRIMERF Forward PCR primer (outermost) (21b)
CTGTGATGGACATCTTTCCAA
>Probe|12645605|PRIMERR Reverse PCR primer (outermost) (19b)
TCTCTCCTGTCCCACATCC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S817
Homo sapienslinkageMarshfield12134.54 cmUT1666

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID39367
Probe Cross-refcontext specific help for: Probe Cross-refGDB:313955
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk