Display Settings:

Format

Send to:

Choose Destination
Pr012638187

STS probe D9S2039 for inversin (INVS) and 3 more genes

Synopsis

Field NameValues
NameD9S2039
AliasesRH35213; SHGC-8789
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesINVS; INVS; INVS; INVS
UniSTS IDUniSTS:38699

Sequences

>Probe|12638187|PRIMERF Forward PCR primer (outermost) (21b)
CTGGAATTGGCAGATTATCCA
>Probe|12638187|PRIMERR Reverse PCR primer (outermost) (21b)
TGACTTGCTCATGGTCTTGAA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G393504 cr10000SHGC-8789
Homo sapienslinkageRutgers Map9 cmD9S2039
Homo sapiensradiation hybridNCBI RH9848.3 crSHGC-8789

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID38699
Probe Cross-refcontext specific help for: Probe Cross-refGDB:739571
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk