Display Settings:

Format

Send to:

Choose Destination
Pr012637911

Homo sapiens STS probe D5S2074

Synopsis

Field NameValues
NameD5S2074
Aliases324VC5; AFM324vc5; HS324VC5; RH30902; RH85560; SHGC-20257; W4963
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:38674

Sequences

>Probe|12637911|PRIMERF Forward PCR primer (outermost) (16b)
CTGGAACCTAGGGGCA
>Probe|12637911|PRIMERR Reverse PCR primer (outermost) (25b)
AGATTAATGATTGTGTTTAAGACCC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Show All 4 References...

3.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

4.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG512329 cr50000SHGC-20257
Homo sapienslinkageRutgers Map5 cmD5S2074
Homo sapienslinkageMarshfield536.25 cmAFM324vc5
Homo sapienslinkagedeCODE540.88 cmD5S2074
Homo sapienslinkageGenethon535.6 cmAFM324vc5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID38674
Probe Cross-refcontext specific help for: Probe Cross-refGDB:612912
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk