Display Settings:

Format

Send to:

Choose Destination
Pr012626762

Homo sapiens STS probe SHGC-14953

Synopsis

Field NameValues
NameSHGC-14953
AliasesRH29886
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:37670

Sequences

>Probe|12626762|PRIMERF Forward PCR primer (outermost) (22b)
CTCTTGATGTTTACCGGACTCC
>Probe|12626762|PRIMERR Reverse PCR primer (outermost) (25b)
AGAGATGTCAATCCAAAATAAATGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3131867 cr10000SHGC-14953
Homo sapienslinkageRutgers Map13 cmSHGC-14953
Homo sapiensradiation hybridNCBI RH13614 crSHGC-14953

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37670
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk