Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012622586

Eukaryota (3 taxa) STS probe D12S2133 for ubiquitin specific peptidase 15 (USP15) and 2 more genes

Synopsis

Field NameValues
NameD12S2133
AliasesRH14244; SHGC-15985
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Pongo abelii; Homo sapiens
Target genesUSP15 (Pongo abelii); USP15 (Pan troglodytes); USP15 (Homo sapiens)

Sequences

>Probe|12622586|PRIMERF Forward PCR primer (outermost) (25b)
CTCTAAGACATTGTATCAAAGCTGG
>Probe|12622586|PRIMERR Reverse PCR primer (outermost) (23b)
TGTCTTGTTTTTAATCCATTGCT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3122582 cr10000SHGC-15985
Homo sapiensradiation hybridGeneMap99-G3122528 cr10000SHGC-15985
Homo sapienslinkageRutgers Map12 cmD12S2133
Homo sapiensradiation hybridNCBI RH12490.3 crSHGC-15985

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37294
Probe Cross-refcontext specific help for: Probe Cross-refGDB:740852
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk