Display Settings:

Format

Send to:

Choose Destination
Pr012620790

Eukaryota (4 taxa) STS probe D17S2130 for myosin, heavy chain 13, skeletal muscle (MYH13) and 3 more genes

Synopsis

Field NameValues
NameD17S2130
AliasesRH34953; SHGC-7176
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesMYH13 (Pongo abelii); MYH13 (Nomascus leucogenys); MYH13 (Pan troglodytes); MYH13 (Homo sapiens)
UniSTS IDUniSTS:37132

Sequences

>Probe|12620790|PRIMERF Forward PCR primer (outermost) (21b)
CTCCTCACTAACCAGCGAGGT
>Probe|12620790|PRIMERR Reverse PCR primer (outermost) (21b)
TTTCTGAGATGTGGATCTTTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G317623 cr10000SHGC-7176
Homo sapienslinkageRutgers Map17 cmD17S2130
Homo sapiensradiation hybridNCBI RH17275.1 crSHGC-7176

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID37132
Probe Cross-refcontext specific help for: Probe Cross-refGDB:736737
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk