Display Settings:

Format

Send to:

Choose Destination
Pr012612961

Homo sapiens STS probe D13S253

Synopsis

Field NameValues
NameD13S253
AliasesHUMUT1378; RH34192; SHGC-4850; UT1378
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:36427

Sequences

>Probe|12612961|PRIMERF Forward PCR primer (outermost) (20b)
CTCAAGGGATGTTAACACAC
>Probe|12612961|PRIMERR Reverse PCR primer (outermost) (20b)
AGGAGGAAAAAGTGGAGAAG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 4 References...

3.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7. Epub 2002 Jun 10.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3132463 cr10000SHGC-4850
Homo sapienslinkageRutgers Map13 cmD13S253
Homo sapienslinkageMarshfield1366.59 cmUT1378
Homo sapienslinkagedeCODE1379.17 cmD13S253
Homo sapiensradiation hybridNCBI RH13602.5 crSHGC-4850

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID36427
Probe Cross-refcontext specific help for: Probe Cross-refGDB:198740
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk