Display Settings:

Format

Send to:

Choose Destination
Pr012610818

STS probe UniSTS:36234 for SH3 domain binding glutamate rich protein like 2 (SH3BGRL2) and 2 more genes

Synopsis

Field NameValues
NameUniSTS:36234
AliasesD6S1164E.1; Cda0tb12; D6S1164E; RH10100; RH16109; stSG6381
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSH3BGRL2; SH3BGRL2; SH3BGRL2
UniSTS IDUniSTS:36234

Sequences

>Probe|12610818|PRIMERF Forward PCR primer (outermost) (20b)
CTATGGTCAACACAAAGTTC
>Probe|12610818|PRIMERR Reverse PCR primer (outermost) (19b)
GACAATAAACAAACCCCTG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB46353.5 cr3000stSG6381
Homo sapienslinkageRutgers Map6 cmUniSTS:36234
Homo sapiensradiation hybridNCBI RH6933.3 crstSG6381

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID36234
Probe Cross-refcontext specific help for: Probe Cross-refGDB:443367; GDB:448733
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk