Display Settings:

Format

Send to:

Choose Destination
Pr012610578

STS probe REN37323 for stereocilin (STRC) and 9 more genes

Synopsis

Field NameValues
NameREN37323
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100434832; STRC; STRC; STRC; STRCP1; LOC649975; LOC649989; LOC731396; LOC742617; LOC749494
UniSTS IDUniSTS:362123

Sequences

>Probe|12610578|PRIMERF Forward PCR primer (outermost) (21b)
AAGCTGTGGCTCCCTACACAG
>Probe|12610578|PRIMERR Reverse PCR primer (outermost) (23b)
AAAGAGGGCAAAGGATATGAAGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID362123
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk