Display Settings:

Format

Send to:

Choose Destination
Pr012610577

Eukaryota (5 taxa) STS probe REN37322 for stereocilin (STRC) and 10 more genes

Synopsis

Field NameValues
NameREN37322
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100434832 (Pongo abelii); STRC (Pongo abelii); STRC (Nomascus leucogenys); STRC (Homo sapiens); STRCP1 (Homo sapiens); LOC649975 (Homo sapiens); LOC649989 (Homo sapiens); STRC (Macaca mulatta); LOC731396 (Homo sapiens); LOC742617 (Pan troglodytes); LOC749494 (Pan troglodytes)
UniSTS IDUniSTS:362122

Sequences

>Probe|12610577|PRIMERF Forward PCR primer (outermost) (24b)
GAGGCTTGAAGATCATCCCTCTAA
>Probe|12610577|PRIMERR Reverse PCR primer (outermost) (22b)
ACAGCTGTGTAGGGAGCCACAG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID362122
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk