Display Settings:

Format

Send to:

Choose Destination
Pr012609696

STS probe D8S1068 for RB1 inducible coiled-coil 1 (RB1CC1) and 3 more genes

Synopsis

Field NameValues
NameD8S1068
AliasesMH170; RH34655; RH62343; RH7285; SHGC-6379; WI-491
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesRB1CC1; RB1CC1; RB1CC1; RB1CC1
UniSTS IDUniSTS:36133

Sequences

>Probe|12609696|PRIMERF Forward PCR primer (outermost) (22b)
CTATCAAATCTGAAGGACACCC
>Probe|12609696|PRIMERR Reverse PCR primer (outermost) (25b)
CACTGTTTTAACAAGAGAGAAAATG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Show All 3 References...

3.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G382095 cr10000SHGC-6379
Homo sapienslinkageRutgers Map8 cmD8S1068
Homo sapiensradiation hybridNCBI RH8768.8 crSHGC-6379
Homo sapiensradiation hybridWhitehead-RH8367.7 cr3000WI-491

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID36133
Probe Cross-refcontext specific help for: Probe Cross-refGDB:354975
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center