Display Settings:

Format

Send to:

Choose Destination
Pr012605142

Homo sapiens STS probe D10S1409

Synopsis

Field NameValues
NameD10S1409
AliasesD10S1452; D10S2230; HALD30E11; MR4235; WI-3379
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:35723

Sequences

>Probe|12605142|PRIMERF Forward PCR primer (outermost) (24b)
CTACCACCTCAATAAAAGTTGCTG
>Probe|12605142|PRIMERR Reverse PCR primer (outermost) (24b)
TTCCCCTAAATGTACAGAAGAACC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmD10S1409

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID35723
Probe Cross-refcontext specific help for: Probe Cross-refGDB:452960
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk