Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012600887

Pan troglodytes and Homo sapiens STS probe D7S652 for coiled-coil domain containing 132 (CCDC132) and 1 more gene

Synopsis

Field NameValues
NameD7S652
AliasesAFM254xd5; RH13570; RH508; SHGC-1894; stSG1002
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesCCDC132 (Pan troglodytes); CCDC132 (Homo sapiens)

Sequences

>Probe|12600887|PRIMERF Forward PCR primer (outermost) (20b)
CGTTGGGATGCAGTATGTAT
>Probe|12600887|PRIMERR Reverse PCR primer (outermost) (20b)
TGGCACAGAATGTTAGGAGT

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G374285 cr10000SHGC-1894
Homo sapiensradiation hybridGeneMap99-G374285 cr10000AFM254xd5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID35340
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk