Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012600498

Eukaryota (6 taxa) STS probe D14S1184 for protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C) and 5 more genes

Synopsis

Field NameValues
NameD14S1184
AliasesRH8632; SHGC-10966
TypeSTS
Application
Source organism
Source sequence
Target organismsCallithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Equus caballus
Target genesPPP2R5C (Equus caballus); PPP2R5C (Pongo abelii); PPP2R5C (Callithrix jacchus); PPP2R5C (Pan troglodytes); PPP2R5C (Homo sapiens); PPP2R5C (Macaca mulatta)

Sequences

>Probe|12600498|PRIMERF Forward PCR primer (outermost) (20b)
CGTTCCGTAGGCAATAACGT
>Probe|12600498|PRIMERR Reverse PCR primer (outermost) (20b)
GGTGCTTTCCTATCGCTCTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3143827 cr10000SHGC-10966
Homo sapiensradiation hybridGeneMap99-G3144376 cr10000SHGC-10966
Homo sapienslinkageRutgers Map14 cmD14S1184

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID35305
Probe Cross-refcontext specific help for: Probe Cross-refGDB:674552; GDB:675335
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk