Display Settings:

Format

Send to:

Choose Destination
Pr012597164

STS probe REN25249 for leucine rich repeat kinase 2 (LRRK2) and 2 more genes

Synopsis

Field NameValues
NameREN25249
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLRRK2; LRRK2; LRRK2
UniSTS IDUniSTS:350049

Sequences

>Probe|12597164|PRIMERF Forward PCR primer (outermost) (25b)
GGAGTATCAGGGCCAAATACCTATG
>Probe|12597164|PRIMERR Reverse PCR primer (outermost) (28b)
TCTTTCATCTTTAAGAATTTGATTACCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmREN25249

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID350049
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center