Display Settings:

Format

Send to:

Choose Destination
Pr012594433

Eukaryota (4 taxa) STS probe SHGC-24010 for nudix (nucleoside diphosphate linked moiety X)-type motif 10 (NUDT10) and 3 more genes

Synopsis

Field NameValues
NameSHGC-24010
AliasesRH74708; WI-13729
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Macaca mulatta; Pongo abelii; Homo sapiens
Target genesLOC100443622 (Pongo abelii); NUDT10 (Nomascus leucogenys); NUDT10 (Homo sapiens); LOC695921 (Macaca mulatta)
UniSTS IDUniSTS:34759

Sequences

>Probe|12594433|PRIMERF Forward PCR primer (outermost) (20b)
CGGAAAATGCCAAACATACA
>Probe|12594433|PRIMERR Reverse PCR primer (outermost) (20b)
ATGAAACGAAATTGGCCTTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3X2083 cr10000SHGC-24010
Homo sapiensradiation hybridGeneMap99-G3X1296 cr10000SHGC-24010
Homo sapienslinkageRutgers MapX cmSHGC-24010
Homo sapiensradiation hybridNCBI RHX259.8 crSHGC-24010

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID34759
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk