Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012589849

Eukaryota (4 taxa) STS probe STS-R42458 for cyclin D-type binding-protein 1 (CCNDBP1) and 11 more genes

Synopsis

Field NameValues
NameSTS-R42458
AliasesRH74787; sts-R42458
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesLOC100129835 (Homo sapiens); CCNDBP1 (Pongo abelii); LOC100289266 (Homo sapiens); LOC100291085 (Homo sapiens); LOC100292002 (Homo sapiens); TMEM62 (Pongo abelii); CCNDBP1 (Homo sapiens); CCNDBP1 (Pan troglodytes); EPB42 (Pan troglodytes); TMEM62 (Macaca mulatta); LOC709589 (Macaca mulatta); TMEM62 (Homo sapiens)

Sequences

>Probe|12589849|PRIMERF Forward PCR primer (outermost) (21b)
CGACTAAGGAAGCAGAGAGCC
>Probe|12589849|PRIMERR Reverse PCR primer (outermost) (20b)
GAGGTTGGGTGTGTGTACGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415154.73 cr3000sts-R42458
Homo sapienslinkageRutgers Map15 cmSTS-R42458
Homo sapiensradiation hybridNCBI RH15173.3 crsts-R42458

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID34346
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk