Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012583933

Eukaryota (16 taxa) STS probe REN13331 for exostosin glycosyltransferase 1 (EXT1) and 17 more genes

Synopsis

Field NameValues
NameREN13331
TypeSTS
Application
Source organism
Source sequence
Target organismsMus musculus; Rattus norvegicus; Monodelphis domestica; Nomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens; Canis lupus familiaris; Ailuropoda melanoleuca; Loxodonta africana; Equus caballus; Sus scrofa; Bos taurus; Oryctolagus cuniculus
Target genesEXT1 (Monodelphis domestica); EXT1 (Equus caballus); EXT1 (Sus scrofa); EXT1 (Pongo abelii); EXT1 (Oryctolagus cuniculus); LOC100385585 (Callithrix jacchus); LOC100465258 (Ailuropoda melanoleuca); EXT1 (Nomascus leucogenys); LOC100657623 (Loxodonta africana); Ext1 (Mus musculus); EXT1 (Homo sapiens); Ext1 (Rattus norvegicus); EXT1 (Pan troglodytes); EXT1 (Canis lupus familiaris); EXT1 (Bos taurus); EXT1 (Macaca mulatta); LOC728879 (Homo sapiens); LOC731147 (Homo sapiens)

Sequences

>Probe|12583933|PRIMERF Forward PCR primer (outermost) (24b)
GTGCACATACTGAGGTGACAACTG
>Probe|12583933|PRIMERR Reverse PCR primer (outermost) (24b)
CAGCATCTACAAAGGCAAGAAGTG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map8 cmREN13331

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID338131
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5500767
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk