Display Settings:

Format

Send to:

Choose Destination
Pr012581119

STS probe D12S1100 for ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B) and 3 more genes

Synopsis

Field NameValues
NameD12S1100
Alias850b8-R
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesANKS1B; ANKS1B; ANKS1B; ANKS1B
UniSTS IDUniSTS:3356

Sequences

>Probe|12581119|PRIMERF Forward PCR primer (outermost) (20b)
AACTGACCTGTGGACCCAAG
>Probe|12581119|PRIMERR Reverse PCR primer (outermost) (20b)
GAAGCTCTGACGTCTCCACC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map12 cmD12S1100

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID3356
Probe Cross-refcontext specific help for: Probe Cross-refGDB:384782
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk