Display Settings:

Format

Send to:

Choose Destination
Pr012575411

Homo sapiens STS probe AL008934

Synopsis

Field NameValues
NameAL008934
AliasesDJ327A19T7; STSG25727
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:33046

Sequences

>Probe|12575411|PRIMERF Forward PCR primer (outermost) (20b)
CCTCCCTGTGTGCTCTAGCT
>Probe|12575411|PRIMERR Reverse PCR primer (outermost) (19b)
TGCACATCTGAATGGCATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAL008934

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID33046
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk