Display Settings:

Format

Send to:

Choose Destination
Pr012573200

STS probe SHGC-37256 for LEM domain containing 3 (LEMD3) and 3 more genes

Synopsis

Field NameValues
NameSHGC-37256
AliasesRH33814
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLEMD3; LEMD3; LEMD3; LEMD3
UniSTS IDUniSTS:32847

Sequences

>Probe|12573200|PRIMERF Forward PCR primer (outermost) (22b)
CCTATTCTGCTGATGTCACTCC
>Probe|12573200|PRIMERR Reverse PCR primer (outermost) (25b)
TCAATATTTCTCTTTGTTGACAAGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3122720 cr10000SHGC-37256
Homo sapiensradiation hybridGeneMap99-G3122666 cr10000SHGC-37256
Homo sapienslinkageRutgers Map12 cmSHGC-37256
Homo sapiensradiation hybridNCBI RH12512.4 crSHGC-37256

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID32847
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk