Display Settings:

Format

Send to:

Choose Destination
Pr012565514

Homo sapiens STS probe WI-10018

Synopsis

Field NameValues
NameWI-10018
AliasesMR12998; RH37369; stSG7114
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:32155

Sequences

>Probe|12565514|PRIMERF Forward PCR primer (outermost) (25b)
CCCTGTAACATTTTTAGAATGAAAG
>Probe|12565514|PRIMERR Reverse PCR primer (outermost) (20b)
CCAGGATGGTTGTTTATGGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmWI-10018

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID32155
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk