Display Settings:

Format

Send to:

Choose Destination
Pr012565336

STS probe D3S3472 for polypeptide N-acetylgalactosaminyltransferase 15 (GALNT15) and 4 more genes

Synopsis

Field NameValues
NameD3S3472
Aliases207WE5; AFM207WE5; W4895
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100460846; GALNT15; GALNT15; GALNT15; GALNT15
UniSTS IDUniSTS:32139

Sequences

>Probe|12565336|PRIMERF Forward PCR primer (outermost) (16b)
CCCTGGGAAGCCCTTT
>Probe|12565336|PRIMERR Reverse PCR primer (outermost) (20b)
GGTCACATCACGCAGAAGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmD3S3472

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID32139
Probe Cross-refcontext specific help for: Probe Cross-refGDB:594435
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk