Display Settings:

Format

Send to:

Choose Destination
Pr012555735

STS probe D7S1987 for JAZF zinc finger 1 (JAZF1) and 4 more genes

Synopsis

Field NameValues
NameD7S1987
AliassWSS447
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesJAZF1; JAZF1; JAZF1; JAZF1; JAZF1
UniSTS IDUniSTS:31274

Sequences

>Probe|12555735|PRIMERF Forward PCR primer (outermost) (20b)
CCCACTTGAAAAATGACAAC
>Probe|12555735|PRIMERR Reverse PCR primer (outermost) (20b)
AAGCCTTCTCCATGTATTAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmD7S1987

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID31274
Probe Cross-refcontext specific help for: Probe Cross-refGDB:334326
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk