Display Settings:

Format

Send to:

Choose Destination
Pr012555513

STS probe D12S1618 for mitogen-activated protein kinase kinase kinase 12 (MAP3K12) and 1 more gene

Synopsis

Field NameValues
NameD12S1618
AliasesA224YG1; AFMA224YG1; AFMa224yg1; HSA224YG1; RH31240; SHGC-20757; W5774
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMAP3K12; MAP3K12
UniSTS IDUniSTS:31254

Sequences

>Probe|12555513|PRIMERF Forward PCR primer (outermost) (19b)
CCCACTCATCCTCAGGAAG
>Probe|12555513|PRIMERR Reverse PCR primer (outermost) (21b)
CATACAGGAACAGGTGCTCTC

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG1225340 cr50000SHGC-20757
Homo sapienslinkageRutgers Map12 cmD12S1618
Homo sapienslinkageMarshfield1268.16 cmAFMa224yg1
Homo sapienslinkageGenethon1269.9 cmAFMa224yg1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID31254
Probe Cross-refcontext specific help for: Probe Cross-refGDB:607317
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk