Display Settings:

Format

Send to:

Choose Destination
Pr012555313

Eukaryota (6 taxa) STS probe RH12007 for paroxysmal nonkinesigenic dyskinesia (PNKD) and 10 more genes

Synopsis

Field NameValues
NameRH12007
AliasesstSG2533
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Callithrix jacchus; Macaca mulatta; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesTMBIM1 (Pongo abelii); PNKD (Pongo abelii); LOC100288953 (Homo sapiens); LOC100397564 (Callithrix jacchus); ARPC2 (Nomascus leucogenys); TMBIM1 (Nomascus leucogenys); PNKD (Homo sapiens); TMBIM1 (Homo sapiens); PNKD (Macaca mulatta); TMBIM1 (Macaca mulatta); TMBIM1 (Pan troglodytes)
UniSTS IDUniSTS:31236

Sequences

>Probe|12555313|PRIMERF Forward PCR primer (outermost) (18b)
CCCACCCGACAGACTGAC
>Probe|12555313|PRIMERR Reverse PCR primer (outermost) (21b)
TTGTCTTAAGTTGCACTGGGG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB42682 cr3000stSG2533
Homo sapienslinkageRutgers Map2 cmRH12007
Homo sapiensradiation hybridNCBI RH21717.1 crstSG2533

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID31236
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk