Display Settings:

Format

Send to:

Choose Destination
Pr012542375

STS probe STS-X01394 for tumor necrosis factor (TNF) and 11 more genes

Synopsis

Field NameValues
NameSTS-X01394
AliasesRH41030; sts-X01394
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100289233; LOC100290815; LOC100292000; LOC100294154; LOC100294183; LOC100294218; LOC100294268; LOC100294309; TNF; TNF; TNF; TNF
UniSTS IDUniSTS:30071

Sequences

>Probe|12542375|PRIMERF Forward PCR primer (outermost) (20b)
CCAGACTTCCTTGAGACACG
>Probe|12542375|PRIMERR Reverse PCR primer (outermost) (17b)
TACATTGGGTCCCCCAG

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB46119.82 cr3000sts-X01394
Homo sapienslinkageRutgers Map6 cmSTS-X01394

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID30071
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk