Display Settings:

Format

Send to:

Choose Destination
Pr012531509

STS probe ECD09887 for homeobox A2 (HOXA2) and 3 more genes

Synopsis

Field NameValues
NameECD09887
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100503966; Hoxa2; HOXA2; HOXA2
UniSTS IDUniSTS:290928

Sequences

>Probe|12531509|PRIMERF Forward PCR primer (outermost) (20b)
TCTGCTCAAAAGGAGGAGGA
>Probe|12531509|PRIMERR Reverse PCR primer (outermost) (23b)
GATAGATCCTTGCAGATCAGGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmECD09887

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID290928
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk