Display Settings:

Format

Send to:

Choose Destination
Pr012530823

STS probe D15S834 for Bloom syndrome, RecQ helicase-like (BLM) and 3 more genes

Synopsis

Field NameValues
NameD15S834
AliasesMR10400; RH3873; RH54046; WI-5507
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesBLM; BLM; BLM; BLM
UniSTS IDUniSTS:29031

Sequences

>Probe|12530823|PRIMERF Forward PCR primer (outermost) (24b)
CATTTTGATTTTTTTCTTTGTCAC
>Probe|12530823|PRIMERR Reverse PCR primer (outermost) (23b)
TGCATATGAAGGCTTAAGAAACG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmD15S834
Homo sapiensradiation hybridNCBI RH15627.9 crWI-5507
Homo sapiensradiation hybridWhitehead-RH15338.9 cr3000WI-5507

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID29031
Probe Cross-refcontext specific help for: Probe Cross-refGDB:458564
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk