Display Settings:

Format

Send to:

Choose Destination
Pr012527778

STS probe D19S1118 for vomeronasal 2 receptor 21 pseudogene (VN2R21P)

Synopsis

Field NameValues
NameD19S1118
AliasesRH29699; SHGC-14333
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneVN2R21P
UniSTS IDUniSTS:28757

Sequences

>Probe|12527778|PRIMERF Forward PCR primer (outermost) (25b)
CATTGAAGAAAGTGTGATGTTATGG
>Probe|12527778|PRIMERR Reverse PCR primer (outermost) (22b)
GAAACATTGAGTGGAAAGAGGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G319309 cr10000SHGC-14333
Homo sapienslinkageRutgers Map19 cmD19S1118
Homo sapiensradiation hybridNCBI RH192.7 crSHGC-14333

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID28757
Probe Cross-refcontext specific help for: Probe Cross-refGDB:737283
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk