Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012527720

Eukaryota (4 taxa) STS probe ECD06457 for opsin 1 (cone pigments), long-wave-sensitive (OPN1LW) and 4 more genes

Synopsis

Field NameValues
NameECD06457
TypeSTS
Application
Source organism
Source sequence
Target organismsNomascus leucogenys; Pan troglodytes; Pongo abelii; Homo sapiens
Target genesOPN1MW (Pongo abelii); OPN1MW (Nomascus leucogenys); OPN1LW (Homo sapiens); OPN1MW2 (Homo sapiens); OPN1LW (Pan troglodytes)

Sequences

>Probe|12527720|PRIMERF Forward PCR primer (outermost) (19b)
AGGATGTGCGCAGTCAGTC
>Probe|12527720|PRIMERR Reverse PCR primer (outermost) (20b)
ACCTCTGGTGGAGTTGCTGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmECD06457

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID287517
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk