Display Settings:

Format

Send to:

Choose Destination
Pr012527431

STS probe ECD06195 for cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7) (CFTR) and 3 more genes

Synopsis

Field NameValues
NameECD06195
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100130680; CFTR; CFTR; CFTR
UniSTS IDUniSTS:287257

Sequences

>Probe|12527431|PRIMERF Forward PCR primer (outermost) (20b)
TAGAGCACACCATGGGGAAT
>Probe|12527431|PRIMERR Reverse PCR primer (outermost) (20b)
CCCACAGTGAATCCCAGAAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map7 cmECD06195

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID287257
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk