Display Settings:

Format

Send to:

Choose Destination
Pr012517517

Sus scrofa and Cavia porcellus STS probe EEF1A1 for elongation factor 1-alpha 1-like (LOC100156563) and 2 more genes

Synopsis

Field NameValues
NameEEF1A1
AliasesAF013213
TypeSTS
Application
Source organism
Source sequence
Target organismsCavia porcellus; Sus scrofa; Bos taurus
Target genesLOC100156563 (Sus scrofa); LOC100728367 (Cavia porcellus); LOC100735473 (Cavia porcellus)
UniSTS IDUniSTS:278329

Sequences

>Probe|12517517|PRIMERF Forward PCR primer (outermost) (22b)
ATCAAAGCAGTGGACAAGAAGG
>Probe|12517517|PRIMERR Reverse PCR primer (outermost) (20b)
TGGCCAATTGAGACAAACAG

References

1.

A high-resolution whole-genome cattle-human comparative map reveals details of mammalian chromosome evolution.

Everts-van der Wind A, Larkin DM, Green CA, Elliott JS, Olmstead CA, Chiu R, Schein JE, Marra MA, Womack JE, Lewin HA.

Proc Natl Acad Sci U S A. 2005 Dec 20;102(51):18526-31. Epub 2005 Dec 9.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Bos taurusradiation hybridILTX5613 crAF013213

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID278329
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk