Display Settings:

Format

Send to:

Choose Destination
Pr012516989

STS probe UniSTS:277852 for T, brachyury homolog (mouse) (T) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:277852
AliasesT_864
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesT; T
UniSTS IDUniSTS:277852

Sequences

>Probe|12516989|PRIMERF Forward PCR primer (outermost) (20b)
TCTCAGGTTAAGAAGGAAAT
>Probe|12516989|PRIMERR Reverse PCR primer (outermost) (21b)
TTCTAGGTTCTGTCTTTATCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmUniSTS:277852

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID277852
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk