Display Settings:

Format

Send to:

Choose Destination
Pr012516505

STS probe UniSTS:277416 for potassium voltage-gated channel subfamily E regulatory subunit 3 (KCNE3) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:277416
AliasesKCNE3_883; KCNE3_V173
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesKCNE3; KCNE3
UniSTS IDUniSTS:277416

Sequences

>Probe|12516505|PRIMERF Forward PCR primer (outermost) (21b)
CTGATATCGCACCTAAATTAT
>Probe|12516505|PRIMERR Reverse PCR primer (outermost) (21b)
ACGTAAATTTCTGAATCTGTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map11 cmUniSTS:277416

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID277416
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk