Display Settings:

Format

Send to:

Choose Destination
We are sorry, but NCBI web applications do not support your browser and may not function properly. More information
Pr012512444

Pan troglodytes and Homo sapiens STS probe G20689 for peptidylprolyl isomerase F (PPIF) and 1 more gene

Synopsis

Field NameValues
NameG20689
AliasesA006B47
TypeSTS
Application
Source organism
Source sequence
Target organismsPan troglodytes; Homo sapiens
Target genesPPIF (Homo sapiens); PPIF (Pan troglodytes)

Sequences

>Probe|12512444|PRIMERF Forward PCR primer (outermost) (22b)
CATAACACATCATGAGTAGATT
>Probe|12512444|PRIMERR Reverse PCR primer (outermost) (18b)
GAACAAACCTCACTTGAG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmG20689

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID27376
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk