Display Settings:

Format

Send to:

Choose Destination
Pr012511980

STS probe PMC55404P2 for toll-like receptor 2 (TLR2) and 3 more genes

Synopsis

Field NameValues
NamePMC55404P2
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesTLR2; TLR2; TLR2; TLR2
UniSTS IDUniSTS:273341

Sequences

>Probe|12511980|PRIMERF Forward PCR primer (outermost) (19b)
TGTGAACCTCCAGGCTCTG
>Probe|12511980|PRIMERR Reverse PCR primer (outermost) (22b)
GTCCATATTTCCCACTCTCAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map4 cmPMC55404P2

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID273341
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Write to the Help Desk